Sunday, May 20, 2012

DNA Sanger Sequencing

DNA Sequencing


Capillary-based Sanger sequencing is the "gold standard" for routine sequencing in both basic life science research and clinical applications. Whether your goal is to validate a plasmid construct or discover rare genetic mutations in your clinical study cohort, Omega Bioservices offers quick and accurate sequencing of any DNA template of your choice. We use the BigDye Terminator v3.1 chemistry to perform capillary sequencing on our Applied Biosystems 3100/3130/3730xl DNA Analyzers.

Customer Provides:
  •   Standard service: DNA template (PCR product or plasmid) and sequencing primer
  •   No-charge common universal sequencing primers in stock
Customer Receives:
  •   Raw sequence data viewable with a variety of sequence viewers
  •   A PDF of the sequencing trace can be provided upon request 
Turn-around time:
  •   Standard 2-day
  •   Same day service available

Pricing:

  • Standard service starting at $5 per reaction 
  • Same day service and additional services please inquire
Sample Submission:

Template Type/Format Sample Requirements Preparation
Plasmid

100 ng/µL

Minimum volume of 20 µL

Submit DNA in DI water, preferably in capped PCR strips. Omega Bio-tek Plasmid Mini/Midi Kits are recommended for extraction due to consistent yield and purity of plasmid DNA.
PCR Product (purified)

50 ng/µL

Minimum volume of 20 µL

DNA should be free of contaminants, unused primers and dNTPs. Submit in DI water. Omega Bio-tek PCR clean-up kits are recommended (Cycle-Pure, Gel Extraction, Mag-Bind® E-Z Pure)
PCR Product (unpurified)

100 ng/µL

Minimum volume of 30 µL

Additional charges apply for clean-up of unpurified PCR product.
Difficult Sequence

100 ng/µL

Minimum volume of 40 µL

Submit sample in DI water, preferably in capped PCR strips.
Individual Tube

1.5 mL microcentrifuge tube, lypholized or in water at RT

N/A
96-Well Plate A strip cap is recommended for sealing with samples in lypholized form or in DI water at RT 

Full-skirted or semi-skirted plates are recommended. Sealed tightly to avoid evaporation or contamination during shipping.

Prepared samples should be of equal concentration and size. See below for premixing guidlines.

Primer Preparation:

The list of primers below are provided at no extra cost:

Primer Name Sequence (5' -> 3') Bases
 M13 Forward  GTAAAACGACGGCCAGT 17
 M13 Reverse  GCGGATAACAATTTCACACAGG 22
 T7  AATACGACTCACTATAG 17
 SP6  ATTTAGGTGACACTATAG 18
 T3  ATTAACCCTCACTAAAG 17
 CMV Forward  CGCAAATGGGCGGTAGGCGTG 21

If customer wishes to supply their own primer(s), please meet the following guidelines:

  • Primers should be submitted at a concentration of 5 µM in  water at minimum volume of 100 µL
  • High purity, free of salts, EDTA, and other contaminants 
  • No secondary priming sites, mismatches, or significant hair pins (>3bp)
  • Should be 18-25 bp
  • GC content 40-60%
  • Tm (melting temperature) 55-60ºC

* Note: Use of customer primers in a 96-well format requires premixing.

Premixing Guidelines:

  • Template: 300 ng plasmid DNA or 50 ng PCR DNA per well
  • Primer: 3.2 pmol per well (for example, add 2 µL of 1.6 µM primer)
  • Add water to adjust the total volume to 5 µL
Additional services:
  • Exon sequencing and mutation discovery: we will extract DNA from your samples (blood, tissue, cell line and more), design primers for the genes of your interest, PCR amplify the genomic regions, sequence the amplicons in both forward and reverse directions, perform multiple sequence alignment analysis and provide a detailed mutation map.
  • Plasmid library sequencing: we will perform transformation, cell growth, plasmid preparation and full sequencing analysis.
Home   |   DNA | RNA Extraction   |   Plasmid DNA Prep   |   Next Gen Sequencing   |   Genotyping   |   Contact Us
Copyright 2012 by Omega Bio-tek, Inc.